Begonia Maculata Plant

Home > hibiscus_maceio > Begonia Maculata Plant

How do you care for begonias in the winter?


After allowing the tubers to dry indoors for a day or two, until stems fall away, store the tubers in a paper bag inside a cardboard box. In frost-free regions, bring tuberous begonias indoors in pots and withhold water during winter, allowing them to go dormant.Begonia Care in Winter | Home Guides | SF Gate

27547  ❤

.

These species were chosen because they are two of the most widespread Begonia species in a genus of mostly rare endemics (Hughes and Hollingsworth, 2008). The species are known to hybridize (Burt-Utley, 1985), facilitating studies of species boundaries. Primer amplification was tested in seven individuals of the two species (Appendix 1).

A subset of polymorphic markers that amplified reliably in both species was then tested for multiplex compatibility by mixing equimolar ratios of each primer. The PCR multiplexes were then tested on a population of each species (20 individuals) to estimate the genetic diversity of the markers. The primer sequences were BLAST searched against the transcriptome sequence of the divergent Asian species B. Platycentrum) to test for likely cross-amplification of primers in other Begonia species. öctf о BI4021 TGTGTTGCCCTGCAAGTAGA GGAAACCTTTCAGAGCTCCA (AG)5 СС II BI5325 TTCCGGACTGAAAGAAATGG CGTGAGTGGAGTGGTGATTG (TC)5 BI2675 TTCCATTTACTCTCAGCCGC CGTTCTCCTTCGAGGACTTG (GA)7 Begonia (Begoniaceae) inferred from organelle DNA phylogenies.

Biological Journal of the Linnean Society 101: 243-250. BC362* CTTCACCTCGCCTGAACAAC GAGGCGAAATATTATGCGGA (ATG)6 BC672* CCTTGATCGAGAAAGAACCG AAAGCCAGCTCCTTCCTGTA (GAA)8 Thomas, D.

West to east dispersal and subsequent rapid diversification of the mega-diverse genus Begonia (Begoniaceae) in the Malesian archipelago. Journal of Biogeography 39: 1365-2699. BC932* GTAGTCCATCAGTCCGCCAT GAGTGATGAAGGCGAAGAGG (GA)5 Dewitte, A.

The origin of diversity in Begonia: Genome dynamism, population processes and phylogenetic patterns. ], The dynamical processes of biodiversity: Case studies of evolution and spatial distribution. InTech Press, New York, New York, USA. The early evolution of the mega-diverse genus BI3970 TGTGTTCACTCAATTCTGCCA TCCTTCACCTGAGACGACAA (TC)5 BEI7112 2 0.

522 4 2Royal Botanic Garden Edinburgh, 20A Inverleith Row, Edinburgh EH3 5LR, United Kingdom; 3Institute of Molecular Plant Sciences, School of Biological Sciences, University of Edinburgh, Edinburgh EH9 3JH, United Kingdom; and 4Institute of Evolutionary Biology, School of Biological Sciences, Ashworth Laboratories, University of Edinburgh, Edinburgh EH9 3JT, "Я З^з S с BI4004 F: R: Ml 3 - T CAGGAAAT AT TCGAT T GGGA GCATTCCTCTGTGTACAATGC 2 VIC 59 (AT), 2 3 155-169 O-fucosyltransferase family protein 1E-32 BI4848 F: R: M13 - С GAC GC С T С T С AAAGAAGAA GAGCTTTGAATTTCGCTACG 59 (AG)6 4 2 71-74 arabinogalactan protein 6E-07 3 X gl ft, и ffl ее BI6761 TGTTCTTCCGCTCTCCACTT ACATGCTCTTCCTGGCTTGT (TC)5 BI3741 GCAACACAGCTCCTCTTCGT GGTCGGAATCGTCGAGTAAA (CT)7 markers for Central American BEGONIA sect

. GlREOUDIA BI6701 F: R: M13-AGAAT CCCCACTCACTGCAC GAGAT GAT GAGGGT T CAGGC 60 (GA)6 JM JM 195 BC402 F: R: M13-TTACTCGAGCTAGAAGCCGC AGGGCTTGGAGAGCTAGAGG 60 (AT)5 JM JM 92 Afunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein 3E-09 BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofit publishers, academic institutions, research libraries, and research funders in the common goal of maximizing access to critical research. BI4740 AGGCACCCTCCCAAAGTAAT GCCTGTATCTGAAATTGGCA (GA)7 A Allele * Indicates markers tested for amplification and polymorphism.

Multiplexed assay of 15 loci should enable accurate assignment to hybrid classes (e.

Future studies will use these loci to estimate the genetic structure of populations, the frequency of hybrids, and the extent of introgression in hybrid swarms. BC4G2* TTACTCGAGCTAGAAGCCGC AGGGCTTGGAGAGCTAGAGG (AT)5 'JJ с Maintenance of species boundaries in a Neotropical radiation of Begonia 2015 / Alex D. Ennos BI6605 TCAAAGCTTCGTTCCCATTC GGAAAGCGTCAGAGTTGAGG (TTC)) BI134 F: R: M13-ATCAGCTCACTCCCTATCCTCT TGCAATCTCCTTCGGTTCTT 2 VIC 60 (CT)6 4 2 306-314 — - Brennan, A.

Genomic resources for evolutionary studies in the large, diverse, tropical genus, Begonia. Tropical Plant Biology 5: 261-276. A revision of Central American species of Begonia section Gireoudia (Begoniaceae). Tulane Studies in Zoology and Botany 25 : 1 - 131.

BI3403 TGTAGGAACAACGGTTAGCG CGTAGAGACGATTTCCTTAGCC (GAA)6 doi:10.

э 3 I BI4600 GCTATGGGAAGTTGCTTGGA AGCTCTTCCTCCCTTTCTGG (AGA)7 Academic research paper on topic " Development and Characterization of Microsatellite Markers for Central American Begonia sect. Gireoudia (Begoniaceae) " BI4477 F: R: Ml3-GGATCTCCTCTGCTTTGCTG GGCGAGACСAGAAGAAAAGT T 60 (CT), 4 2 111-119 — - BI6294 F: R: M13-TGCTGGTCTGAATCTTTAATCA TGGGGTCTTGGTACTCTTTCC 59 (AT)10 JM JM 148 catalytic LigB subunit of aromatic ring-opening dioxygenase family 3E-13 BI3553 TCTGAAATAGCACCGCTTCC TTTCTTCGATGAACGCACTG (AAG)5 BI5162 CTCTGAAACTCGCTCATCCC GCTCTTTCCGTCTCATTTGC (AGG)5 BI6561 CTTCTGAGACTCGTACCGGC TAGCTCGGTTCAAAACACCC (GTG)5 Published By: Botanical Society of America Appendix 2.

BI7023 TTAAGGCGGTGACACAGAGA CCTTTCGTCTGCAAATGGAT (GAA)5 BI3043* CGACATCCAACCAAACCTG TTGATAGATGGAAGGGTCGC (TC)5 Development and Characterization of Microsatellite Markers for Central American Begonia sect. Gireoudia (Begoniaceae) – topic of research paper in Biological sciences. Download scholarly article PDF and read for free on CyberLeninka open science hub.

Locus Forward primer sequence (5'-3') Reverse primer sequence (5'-3') Repeat motif * Applications in Plant Sciences BC344* GAGGGAGGGTCCCTTGTTAG CCGTCTTACGTTGCATCATC (GCA)5 BI5347* TCAGTCCATTTTCTTAATCAGACC CTCTATCATTTCCAAGCGATTTC (CTT)6 BC552* TGTCTGAGATGGAAACTGCG TAGTCGAAGGGATCCGAATG (TG)5 BI4987 AGTGAAAACCTTGGCACCAC ACCCTTTTCCTATTCCACGG (GAG)5 Applications in Plant Sciences 2013 1(5): 1200499; http://www. Org/loi/apps © 2013 Botanical Society of America о ►J BI143G CACAATTCGTGAAAACACGG TTCTGCATGATGTTGGCTTT (GA)5 BI2935 TGGAAGAAGGTCTCCATATAAGTCA CATGTTTTCTTCGCCCATTC (CAC).

BI3286 CCTATGATGATAGCGTCCGA AGGCCGACATTCTTTTCCTT (CT)U BI4779 CGAAGGAGGAAGAGACGATG TGGCACTATAATTCCAAGCTCC (AACG)5 BI3348 F: R: M13-ACTT GT TT CTCGT T GGGAGC CTGCAGCCCAGTGGATTTAC 1 PET 60 ÎCT)6 3 3 279-283 — - 1— tT BI4128 AAGACAACGCCATTCCAAAC AGGGACGACCGGAAGTAGAG (CT)5 С? с а, 3 " odd BI1733 GTTCACCACTCCAATGGCTT CGAGTTTGCCTTCGAATCTC (GCCACA)5 We have described the development of nuclear microsatellite primers that amplify in two divergent Central American Begonia species. Some of the primers have exact BLAST matches in the transcriptome of the Southeast Asian species B. Venusta and, therefore, may be transferable more widely across the genus.

The transferability of markers is important for the study of natural hybrids, and the development of a BIG537 CAGATCAACCCTCTTCCTGC ATCGAAAACCCATTGACTGC (CCT)6 The authors thank H. Sanchez for help with fieldwork, and A.

Ruhsam for help and advice in the laboratory. This work was funded by a BBSRC studentship to A. 5Author for correspondence: adtwyfor@syr. Edu BI5317 GCCCTCAAGTTCCTCCATCT GGGACCGTCGATTATTCTCA (AT)5 BI6534* CGTTGCTCTGCTCTAACCCT AGATACAGCCAACCGGATTC (TC)6 BI7287 TTGGGGACAACAAATGATGA CAGTGCTTTCTTTAACAACGCTT (TGA)5 BI6294* TGCTGGTCTGAATCTTTAATCA TGGGGTCTTGGTACTCTTTCC (AT)1 0 SD 1.

327

  • Conclusions: The markers developed will be a valuable genetic resource for medium-throughput genotyping of Central American species of Begonia sect. A subset of these markers have perfect sequence matches to Asian B.

    Venusta, and are promising for studies in other Begonia sections. li BioOne" (Begoniaceae)1 Additional loci tested BI5561 GTTGACTCGTCCTCGTCTCC GTCGTTTCTGCCGATTCTTC (CTT)5 BC643 GGAGGAGCTCGGTCATTAGA AACCACCGGTACCCTCATTT (CT)6 BC192 AAGTCAAACCTGTTGACCCG ATCCTCATCGGATTCGTCAT (GAT)9 О' -ti BI6984* GTATGCAAAGGAGAGCCGAG TTGTCAATTCTCACCAGACACA (TC)6 Twyford, A. Population history and seed dispersal in widespread Central American Begonia species (Begoniaceae) inferred from plastome-derived microsatellite markers. Botanical Journal of the Linnean Society 171: 260-276

    .

    BI06604 F: R: M13-ATTTTTC СACAGAAGAGCGC GGCAGAACCCGCAGTATATC 59 (AT)8 6 1 111-127 — - BI6901 CGAACTGGAAGAAGACTACAATCA GCTGCAGCACGGAGTTTTAG (AG)8 Schuelke, M. An economic method for the fluorescent labeling of PCR fragments.

    Nature Biotechnology 18: 233-234. BI5107 CGCGTTTTACATGGCTGAAT CGATTGAAAACCTTGAAGATGA (AT)5 Note: A = number of alleles per locus; At = total alleles observed in the two species; He = expected heterozygosity; Ho = observed heterozygosity.

    QDD: A user-friendly program to select microsatellite markers and design primers from large sequencing projects. Bioinformatics (Oxford, England) 26: 403-404. Unknown PCR inhibitor that coelutes with DNA extractions in Begonia, extractions were diluted 100-fold with Millipore dH2O to a final DNA concentration of -0. PCR reactions were performed using the M13-tailed primer method (Schuelke, 2000) in a final reaction volume of 10 |L containing: 0.

    5 |L of 1 mM M13-tailed forward primer (Invitrogen, Grand Island, New York, USA), 1 |L reverse primer (1 mM), 1 |L of 1 mM M13 fluorescently modified primer (6-FAM,VIC, NED, PET), 0. 25 |L bovine serum albumin (BSA, 0. 4%), 1 |L of 10x reaction buffer, 1 |L of 2 mM dNTPs, 0. 05 |L BIOTAQ polymerase (Bioline, London, United Kingdom), 1 |L dilute DNA template, and made up to the final volume using dH2O. PCR cycles consisted of an initial denaturation of 1 min at 95 °C, followed by 40 cycles of de-naturation for 1 min at 95 °C, annealing for 1 min at 57 °C, and extension for 1 min at 72°C.

    Five microliters of each PCR product labeled with the four fluorescent dye colors was pooled and diluted 2x in Millipore dH2O, and the GeneScan 500 LIZ internal size standard (Applied Biosystems, Foster City, California, USA) was added prior to fragment analysis on the ABI 3730xl analyzer (Applied Biosystems; analysis was performed at GenePool, University of Edinburgh, Edinburgh, United Kingdom). Fluorescent traces were analyzed automatically with manual editing using GeneMapper version 4.

    Development of 18 Novel Microsatellite Primers forBegonia fimbristipula(Begoniaceae), an Endangered Medicinal Plant in China 2016 / Bo Zhao, Yun-Qian Du, Jing-Jian Li, Wen-Xiu Tang, Shu-Hua Zhong BI4028 GTCTTCTCCCCATCGTTGAA GGGCTTTGGAAACATCTCCT (CT))5 BI3820 F: R: M13-AGGACCAGTTTTGACGGCTA GAAGCTTTTGCTCTTCTGTTGA 2 FAM 59 (CTT)7 5 2 158-176 LOB domain-containing protein 2E-39 Development of Nuclear Microsatellites for the Arcto-Tertiary Tree Zelkova carpinifolia (Ulmaceae) Using 454 Pyrosequencing 2014 / Elmira H. Muller, Nadja Korotkova, Thomas Borsch BI4031 TCTTCGCTCTAAAGGCTTGC AAATTTCGCCAAACATGGAG (TC)5 BEI5347 3 0. 449 1 — — 4 BI3384 ATAATTGGGCTAGGGTTCGG GCTTTTGGTTGCTTCAGAGG (TC)5

    000002 BI5800 CGCCTCCCATATCTCGTAAA GGAAGGTGATGGTTGTTGCT (TCT)5 BI5285 GGTCAAATGGGTAACATGCC CTGGTTCATCATCGCTGCTA (GGT)5 Key words: Begonia heracleifolia; Begonia nelumbiifolia; Begoniaceae; hybridization; microsatellite primers; transcriptome sequences. BI3865 ACCTCACTCAACCGCCATAG TTCAGCATCTGTTGCAGGAC (CT)5 -Я-й! « DOI: http://dx. 1200499 BI6701* AGAATCCCCACTCACTGCAC GAGATGATGAGGGTTCAGGC (GA)6 Ч 2 ^ «= BI7015 TGGTCCAGATTATGATCAGCC TCTTCTCCGATTCCGATCAC (GAA)5 BI4804 TCGCTGATGATTTGTTTGGA AGAATGCCGACGAAATTGAG (TCT) )0 BEC552 1 — — 3 0. 229 3 BI2875 CCCAATCTCCCTGTCTATCG AAGCTGACGAAGCTCTTCCA (TC)5 1 Manuscript received 21 September 2012; revision accepted 10 November 2012.

    1200499 BC652 TTTCGTCCATGAAGAAAGGC TCCAGGGAACTCCATCACTC (GAA)5 BI6278* TGTAGTTGTTGTAGTAGCAGAACTTTG CAGATGGGTCGGAGATTTTG (TCC)7 BI2967 GGTGGCTTGTACGGTGAGAT TCGATTCTCAAATGCCTTCA (GAA)5 BI6776 CCAAACAGCAAAACTCTTCG GTTTTGTGGAAGGGTGGCTA (AG)5 BC632 CATAGCGCTCAGCTTGCTC GAGATCTTATACGAGCTACTGGATAGT (TC)9 Microsatellite Markers for Hoop-Petticoat Daffodils (Narcissussect. Bulbocodii; Amaryllidaceae)1 2016 / Kálmán Könyves, John C. David, Alastair Culham BC42* GAAGGGGTTTCTTGGTCTCA TTGTCAATTCTCACCAGACACA (TGG)6 Applications in Plant Sciences 2013 1(5): 1200499 BI6849 CCTCAGATCCAGAGGAAGGG GCGCCTTTTCCTTTAAGTCC (TA)6 Locus Primer sequences (5'—3')a Multiplex1' Fluorescent dye тт со Repeat motif her nel sizes (bp)d Putative function"5 E-value BEC332 4 0.

    495 5 BI6067 CAGCTTGGAAAATCAGACCC AGGGGCGTAAGCATAAAGGT (TA)5 B. Nelumbiifolia BI6399 CTGTCATCATCCCCATCACA CAGTGAGAAATGCAGGGTCA (TC)5 In this study, we describe the development of nuclear microsatellite markers to study gene flow within and between Central American Begonia species. This requires markers that amplify over a broad phylogenetic scope, which can then be cross-amplified in divergent species.

    S "ÎÏ " ад n ti BC312* ATTTCCTTCTGCGAACGATG ATCGGAACTCTGAGCCTGAA (GA)5 Development and Characterization of Microsatellite Markers for Central American Begonia sect. Gireoudia (Begoniaceae) Academic research paper on " Biological sciences" BI4848* CGACGCCTCTCAAAGAAGAA GAGCTTTGAATTTCGCTACG (AG)6 Development of Multiplex Microsatellite PCR Panels for the Seagrass Thalassia hemprichii (Hydrocharitaceae) 2014 / Kor-jent van Dijk, Jane Mellors, Michelle Waycott BI3301 GCATGGAGATTGCCAGATTT CTATTGCTCAGCGGAGAAGG (GAA)5 BC6G2 GCAAAGCAGGTAACTTTTAGCC ACTCACCGAACTTTGGCAAC (CAG)5 BI1816 GTTTTGCGGTTGAGTTTGGT CAAATGAATCTTCTTCATCCAGTG (GAT)7 BI3600 CATTATTTCCTGTCGGGACG TGCTGAAAAGTTGCAGGAAA (TGTT)5 BI3727 CCTCCACCAGATTTGCTTAAA AACAGAAACATTTGCCGGTG (TC))2 -О о BI6886 TCTTCTCACGGCTCTCCATT TGGAAATCAAGGAAAGCACC (CTT)5 BI6535 AAAGGGGAAAGCAAGGAAAA GGGATGGATGGCTGATTAAA (GAA)7 BI3131 ACATTGTGTTCAATGGCGAA GAGCTCATGCAATGCTTCAA (GAA)6 BI6581 TTGCTTTTCCTTTCTCATCCA CCGATTCCAGCTCTATCAGC (TTC)) Development and Characterization of Microsatellite Markers for Central American Begonia sect. Gireoudia (Begoniaceae) í — BI3069* AACCACAGTAATCATCCGGC TGTCCGGTAACTGTGGTGAA (CA)5 a U л Primer Note Table 2.

    Genetic diversity in population samples of Begonia heracleifolia and B. BI4004* TCAGGAAATATTCGATTGGGA GCATTCCTCTGTGTACAATGC (AT)5 BEI06534 5 0.

    201 7 BI6423 ATATTGGACATGCCAGCACA CATGAAACAAGAACTCTGGAGAA (AG)5 Table 1. Characterization of nuclear microsatellites for Central American Begonia species

    . Source: Applications in Plant Sciences, 1(5) 2013. Microsatellite loci in the transcriptome of Begonia plebeja. BI5593 ACTCCAAATTAGGTGCGTGG AGATAACGAAGCAAAGCGGA (AG)9 BI5091 TGCTTTCCAGGTTCATAGGG GGCAAGCTTGGAACTTTTGT (AGA)7 BEI6278 1 — — 3 0. 668 4 BI1937 TCATCATCGCAGCAGAAGAC CGAAGCTGGGAGTGAGTTTC (GGA)6 BEI3820 5 0. 108 6 BI6141 GTCGCCATGACGATAAGGTT TCTGACCCTGAAGATGGACC (AG)1 0 BI4594 CCAGAATCGTGGTCACTTCC CGTGAATCGAAACTTCTCCC (TC)9 BI6278 F: R: Ml3-T GTAGT T GT T GTAGTAGCAGAACT TT G CAGAT GGGT CGGAGAT T T T G 1 VIC 59 (TCC)7 1 3 238-253 DOF zinc finger protein 3E-25 BC552 F: R: M13-ТGTCTGAGATGGAAACT GCG T AGT С G AAGGGAT С С GAAT G 1 NED 60 (GT)5 2 2 271-273 — - BI6299 CATCGCTCTATGAAGCTGCTACT CCTGAGACCCTGCTATTCCA (AT)5 R : GAGT GAT GAAGGCGAAGAGG BI6828 TCGTCTCCTTCTTCGTCTCC GGTCGTCGCTCTGATTCTTC (CTC)5 BI5710* GAAAGTTTTGGAGGAAGCCC TGGAAGAGATCAGAAGGTACA (GAA)7 BC432 F: R: M13-AAACTCCGATGGATTCAGCA T GAAATAAACACACAAACAAAGACA 1 FAM 60 (TG)5 1 1 261-263 endotrans glucosylase/hydrolase 5E-18 Usage of BioOne content is strictly limited to personal, educational, and non-commercial use.

    Commercial inquiries or rights and permissions requests should be directed to the individual publisher as copyright holder. Comparison of random and SSR-enriched shotgun pyrosequencing for microsatellite discovery and single multiplex PCR optimization in Acacia harpophylla. Molecular Ecology Resources 11: 711-724.

    BC332 F: R: Ml3-GAACCAGAAGT CAAGGGTT СA AAAC AT GAT T T T C. AA 2 PET 59 (TCA)5 4 2 188-200 ATPase 1. Information on Mexican Begonia voucher specimens deposited in the herbarium at the Royal Botanic Garden Edinburgh (E). Information presented: taxon, collection number, collection locality, GPS coordinates.

    I о 3 BI1948 CAAAACTGGCTTTGCAGACA CACGGGCACTTTCAATTTCT (TA)5 BI7247* CTCTTATTCCGCGTCAAAGC AGCGGAGAAGTCGAAAACAG (AG)6 BI7149 CGGAGAATCGAACCTCTGAT CCCTGAACGATGGAACTCAT (CT)5 BC762 CAACTCTGCAAATGCAAGGA ACCCATGACAGCATGAACAA (CT)5 BI7165 AATGAGCACGAACCTGCTTT GAGGAATTTGGACCGTCTGA (AG)5 BI4166 CGGGACAAATGTTAAGCGAT CAATAAAGAACTTCCGGCGA (TG)5 Approximately 15 mg of silica-dried leaf material was extracted using DNeasy 96-sample kit (QIAGEN, Germantown, Maryland, USA). To overcome an BEC344 1 — — 2 0.

    097 2 BI4641 GCCACAGTTTTAGCTGTGCTAT CTGCAACCACGAGGAGTTTA (CT)5 ACd. Ae BI1195 TGCTGCAGAAACTTTAGCCA CGGTGATTAAAGAAGAGCAAGAA (GA)1 1 BI05710 F: R: M13-GAAAGTTTTGGAGGAAGCCC T GGAAGAGAT CAGAAGGT АСА 60 (GAA)7 3 1 178-184 — - BI3348* ACTTGTTTCTCGTTGGGAGC CTGCAGCCCAGTGGATTTAC (CT)6 BEI03043 4 0. 630 4

  • Methods andResults: The transcriptome from vegetative meristem tissue from the related B
    .

    Plebeja was mined for microsatellite loci, and 31 primer pairs amplified in the target species. Fifteen primer pairs were combined in two multiplex PCR reactions, which amplified an average of four alleles per locus.

    097 3 BC752 GGCAGATTTTACTGGGACGA CGCCCATCTATCTGTATCCAA (TTC). BI4175 GGCGATCAAAGGGTGATTTA CGATTAGCCTCTTCTCGACG (AG)5 BI4279 GGGAGGAAGAGGAAGAAGCA TCAGATTCAGCGTCATCAGAA (AGG)6 BI06534 F: R: Ml3-CGTTGCTCTGCTCTAACCCT AGATACAGCCAACCGGATTC 1 PET 59 (TC)6 6 2 97-107 sterol 4-alpha-methyl-oxidase 2-1 7E-57 BI4329 F: R: M13-СAACСAACДАТ GGCAGOTT CAT GGAGAT AAT GGAGCT GG 1 FAM 59 (GGA)6 4 2 89-104 immunoglobulin E-set superfamily protein 2E-13 BI7036 TTGAGCAGGCTTCCAAACTT ATTCGAAGGAAGAAGACGGC (CTT)5 BI6469 TCTAGGCGCCAAAAGAAAGA CTCCCTCATCACTTGCGAAT (GA).

    Kidner2,3 A total of 136 primer pairs were located in the B. Plebeja transcriptome using the QDD bioinformatic pipeline (Appendix 2). All 31 of the subset of primers tested for amplification yielded a PCR product (Table 1).

    Sixteen loci had a significant (

    All loci were polymorphic in at least one of the populations tested, and showed moderate genetic diversity, with the number of alleles per species ranging from one to five and the expected within-population heterozygosity between 0 and 0. Twenty-one of the 62 primers (34%) had perfect BLAST matches in the transcriptome of the divergent B.

    Venusta, including both the forward and reverse primers for loci BI3348, BC932, and BC552.

  • Premise of the study: Transcriptome sequence data were used to design microsatellite primers for two widespread Central American Begonia species, B.

    Nelumbiifolia, to investigate population structure and hybridization. BC532 TCATTCCGCTTCTATGCTCC CGTCATCGTCAATATCATCCTC (TGA)6 я ее protein и ее Begonia heracleifolia Cham. 32781; AT819, Santa María Jacatepec, 17.

    78714; AT1G8G, Santa María Xanabi, 15. 623 4 BI4233 ATGCAGACGTAATCGAAGGC CAAGTTGGTTGGCAAAGACA (AG)1 2 BC332* GAACCAGAAGTCAAGGGTTCA AAACATGATTTTCCTCATCCAA (TCA)5 BI7085 ACTCGCGAATATCTCCGAAA CACCTCTTCAGCTCGTCTCC (GA)5 BI6604* ATTTTTCCACAGAAGAGCCC GGCAGAACCCGCAGTATATC (TA)8 BC692 AACATGGCCGTCACTAGTCC CAGGCAGACAAAGAAGATTCC (AG)1 1 H О H с BI362 F: R: M13-CTTCACCTCGCCTGAACAAC GAGGCGAAATATTATGCGGA 2 NED 60 (ATG)6 4 4 147-159 Acyl-CoA N-acyltransferases (NAT) superfamily protein 1. 00E-45 BI4721 ACTACCCTCCCAAGGCTGTT GGCCAGAAGTCAAACCTCAA (TC)8 BI7112 F: R: Ml3-ATCCAATGTCAACCTCTCGG GT GCAT TAGAGT CCCGTGGT 2 FAM 60 (TCC)6 2 2 109-115 — - Author(s): Alex D. Org) is a nonprofit, online aggregation of core research in the biological, ecological, and environmental sciences. BioOne provides a sustainable online platform for over 170 journals and books published by nonprofit societies, associations, museums, institutions, and presses.

    BC672 F: R: Ml 3 - С С T Т GAT С GAGAAAGAAC С G AAAG С CAGCT CCT T CCT GT А 60 (CTT)8 3 1 152-158 cellulose-synthase-like C12 2E-57 BI6717 GATCTCGGGGATTTGGATTT ACTGCCATAGCCTCCATCAC (GTG)5 Hughes, M. Population genetic divergence corresponds with species-level biodiversity patterns in the large genus Begonia.

    Molecular Ecology 17: 2643-2651. BI5377 ATCCTCTTCCTATCCACCGC GGGAGACGGTGAAACTCTGA (TC)5 BI7059 CTCCCTCCGACCTCCATAAC TAGCCTTCTGCGGAGTGTTT (CT)5 Begonia L. Is a diverse tropical genus with over 1500 species.

    Evolutionary research has focused on the early-diverging African species (e. , Hughes and Hollingsworth, 2008) and the more derived Asian species (e. , 2011), with the American species largely overlooked.

    The most recent common ancestor of Central American Begonia is likely to be relatively recent (Miocene; Dewitte et al. , 2011), and subsequent specia-tion has resulted in high species richness (total c. 690 species; Goodall-Copestake et al. Population studies of Central American Begonia species will shed light on the evolution of species richness in a morphologically diverse group of neotropical herbs; but to date, studies have been limited by the availability of suitable nuclear markers to complement plastid microsatellite markers (Twyford et al.

    BI4088 GGTTTCGAGATATGGCCTCA TTGGCAATTTATCCCTCCTC (GGC)5 Development and characterization of microsatellite Locus A Ho He A Ho He At BI5813 CGGTAGATTGAATGGGGAGA AGCATCGCCTCAAGTTGTCT (AG)5 BC232 TGGAAATGCTGTCGTTGAAT ATTGGAGAAAAGGCAAAGCA (TCT)8 BEI3348 4 0. 665 5 BI4746 GTCGGAGTCAGCGAGGGA TGATCCTATGCACTCGTGGT (AG)5 BI4899 CCCATTTGCTTCCAAAACAT GAGTCGAGGAGCAGCACTCT (GAA)5 BI4329* CAACCAACAATGGCAGCTT TCATGGAGATAATGGAGCTGG (GGA)6 BI3377* AACACAATCATCAGCCGGAC ACGAAGGAGATGATTATGACGAA (AGG)5 BC932 F: Ml3-GTAGTCCATСAGT CCGCCAT 60 (GA)5 2 1 660-662t cysteine proteinase superfamily 0.

    145 5 BI5668 TATGGGTCCGGATATGGAAA AGGAAGAGCTCGAAGAAGCC (GCG)5 B. Heracleifolia BI5414 GCAAAGCAAAGCTGAAAACC GGCCCAGTCTACCTGCAATA (AT)5 BI5588 CAGCTGGTTGAGAAACGTGA AATCATATCGCCGATCAAGG (TC)5 BI2994 GATTTCCGTGGAGGAAACAA AAACATCACCAGAGCACAACA (CT)5 1 of 6 Begonia nelumbiifolia Cham. G7876; AT125, San Andrés Tuxtla, 18.

    78714; AT1G29, San Jeronimo Zoochina, 17.

    BI6422 TTTGATGGAGAAGATTAGTGAGAAGA AGGCGGAATACCTTGTCCTT (TTC)) BI6227 GACGCGACGAAGATAAGGTA ATACATCGGAGGGAAGCAAA (TCT)5 BI5115 AGACCGATGACCGAACAATC TCCGTCGTTTCTAACCGTTC (TC)5 Similar topics of scientific paper in Biological sciences , author of scholarly article — Alex D.

    Kidner BI7112* ATCCAATGTCAACCTCTCGG GTGCATTAGAGTCCCGTGGT (TTC)) BC432* AAACTCCGATGGATTCAGCA TTGAAATAAACACACAAACAAAGACA (TG)5 Microsatellite markers were designed from the transcriptome sequence of vegetative meristem tissue from B. , a related species from Begonia sect.

    Gireoudia (European Nucleotide Archive Sequence Read Archive accession number: ERP001195; Brennan et al. The QDD bioinformatic pipeline (Meglecz et al.

    , 2010), which integrates microsatellite detection, a redundancy check to avoid amplifying multiple PCR products, and designs primers, was used according to Lepais and Bacles (2011). Plebeja transcriptome sequence assembly was analyzed in QDD version 1.

    3 using default parameters: selecting only primers that amplify a PCR product between 90 and 320 bp in length, with a repeat motif of 2-6 bp repeats, and a minimum length of four repeat units. To make microsatellite amplification in other species more likely, primers were excluded if they did not have a perfect BLAST match to the transcriptome of B. Reads from which the primers were designed were BLAST searched against the Arabidopsis Information Resource (TAIR) database (http://www.

    Org) to investigate the putative function of each locus. BI2946 ATTTGAAGCCATTGGGTCTG AAGACGGGAAAGGGTGAGAG (TC)6 BI2961 TCGCAAAAGAAGAAATCACAAA TCCTCCGGCACAATAATCTC (GAA)6 METHODS AND RESULTS Multiplexed loci.

    Begonia Maculata Plant